dhbE [2018-06-21 16:01:51]

2,3-dihydroxybenzoate-AMP ligase (enterobactin synthetase component E)

Locus: BSU31980

Isoelectric point: 5.68

Molecular weight: 59.76 kDa

Protein length: 539 aa

Gene length: 1617 bp

Function: biosynthesis of the siderophore bacillibactin

Product: 2,3-dihydroxybenzoate-AMP ligase (enterobactin synthetase component E)

Essential: no

Synonyms: entE

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Acquisition of iron → Acquisition of iron / Other
• Metabolism → Additional metabolic pathways → Iron metabolism → Acquisition of iron / Other

Gene

Coordinates: 3,288,641 → 3,290,260

The protein

Protein family

• ATP-dependent AMP-binding enzyme family (according to Swiss-Prot)

Structure

• 1MDB (complex with DHB-adenylate), 1MDF

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: dhbA-dhbC-dhbE-dhbB-dhbF-ybdZ
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigI: sigma factor, PubMed, in SigI regulon

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • Kre: repression, in Kre regulon

  Regulation

  • induced by iron starvation (second wave to allow iron scavenging from the environment) (Fur) PubMed
  • expression of the operon is strongly induced at the beginning of biofilm formation PubMed

  Additional information

  • the dhbA-dhbC-dhbE-dhbB-dhbF operon is strongly unregulated in a kre mutant PubMed

Biological materials

Mutant

• BKE31980 (ΔdhbE::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTGTATCCCTCCAGCA, downstream forward: _UP4_TAAAACAACAATTTGAGAGG
• BKK31980 (ΔdhbE::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTGTATCCCTCCAGCA, downstream forward: _UP4_TAAAACAACAATTTGAGAGG

Labs working on this gene/protein

• Mohamed Marahiel, Marburg University, Germany homepage

References

Loading